circad | circRNAs associated with diseases

hsa_circ_0054345
Gene	LRPPRC	Organism	Human
Genome Locus	chr2:44139570-44145537:-	Build	hg19
Disease	Irradiated Hepatic Stellate Cell (HSC)	ICD-10	Fibrosis and cirrhosis of liver (K74)
DBLink	Link to database	PMID	28774651
Experimental Method
Sample Type	LX2 Cell lines	Comparison	two cell cultural groups (normal Hepatic Stellate Cells (HSC) vs. irradiated Hepatic Stellate Cells (HSC))
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATGCTGAAACCTACAGCAATCTCAT Reverse GCATCAGCTCTTTGCCAGTCA	Statistics	Fold Change : Upregulated,2.821915 pvalue : p=0.000435
Citation
Chen, Y, Yuan, B, Wu, Z, Dong, Y, Zhang, L, Zeng, Z (2017). Microarray profiling of circular RNAs and the potential regulatory role of hsa_circ_0071410 in the activated human hepatic stellate cell induced by irradiation. Gene, 629:35-42.